Transcript: Mouse NM_010183.1

Mus musculus fibrosin (Fbrs), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Fbrs (14123)
Length:
2650
CDS:
20..1420

Additional Resources:

NCBI RefSeq record:
NM_010183.1
NBCI Gene record:
Fbrs (14123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341859 GGGTTTCATGTACATATTTAT pLKO_005 1899 3UTR 100% 15.000 12.000 N Fbrs n/a
2 TRCN0000341860 CAAAGAGTCTGTGCGGGTAAA pLKO_005 910 CDS 100% 10.800 8.640 N Fbrs n/a
3 TRCN0000341927 GTACCCACATTGATCCCTTTG pLKO_005 522 CDS 100% 0.000 0.000 N Fbrs n/a
4 TRCN0000341926 GACACAGATCCCTGATCATTT pLKO_005 226 CDS 100% 13.200 9.240 N Fbrs n/a
5 TRCN0000352581 CCTGCTCATCCACTGCTATAC pLKO_005 1235 CDS 100% 10.800 7.560 N Fbrs n/a
6 TRCN0000166572 CCACAAGCTTGACTTTCGGAA pLKO.1 343 CDS 100% 2.640 1.848 N FBRS n/a
7 TRCN0000163873 CACAAGCTTGACTTTCGGAAT pLKO.1 344 CDS 100% 4.050 5.670 N FBRS n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1603 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000178741 CACACACATACACACACACAA pLKO.1 1593 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473299 ACGCCATTTCACGTCCTTGACCCT pLX_317 38.1% 65.4% 68.8% V5 (many diffs) n/a
2 ccsbBroadEn_14245 pDONR223 100% 65.3% 68.6% None (many diffs) n/a
3 ccsbBroad304_14245 pLX_304 0% 65.3% 68.6% V5 (many diffs) n/a
Download CSV