Transcript: Mouse NM_010201.4

Mus musculus fibroblast growth factor 14 (Fgf14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Fgf14 (14169)
Length:
2824
CDS:
26..769

Additional Resources:

NCBI RefSeq record:
NM_010201.4
NBCI Gene record:
Fgf14 (14169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010201.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058626 GCCATTGGAAGTTGCCATGTA pLKO.1 622 CDS 100% 4.950 3.960 N FGF14 n/a
2 TRCN0000436343 ATGGAATGCCCTACCAGATAT pLKO_005 985 3UTR 100% 13.200 9.240 N FGF14 n/a
3 TRCN0000066989 CCAAGGATGACAGCACCAATT pLKO.1 306 CDS 100% 10.800 7.560 N Fgf14 n/a
4 TRCN0000066988 CCTTGCATGATGTTGGTGAAA pLKO.1 654 CDS 100% 4.950 3.465 N Fgf14 n/a
5 TRCN0000066990 GCAAGTTTAAAGAGTCTGTTT pLKO.1 453 CDS 100% 4.950 3.465 N Fgf14 n/a
6 TRCN0000058623 GCAATAATGAATGGAGGCAAA pLKO.1 722 CDS 100% 4.050 2.835 N FGF14 n/a
7 TRCN0000066991 ACCAGGTTATATTGCAGGCAA pLKO.1 242 CDS 100% 2.640 1.848 N Fgf14 n/a
8 TRCN0000066992 GCAAGGCTACTACTTGCAGAT pLKO.1 259 CDS 100% 0.405 0.284 N Fgf14 n/a
9 TRCN0000058627 CCTGAATGCAAGTTTAAAGAA pLKO.1 446 CDS 100% 5.625 3.375 N FGF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010201.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00560 pDONR223 100% 71.5% 70.1% None (many diffs) n/a
2 ccsbBroad304_00560 pLX_304 0% 71.5% 70.1% V5 (many diffs) n/a
3 TRCN0000478594 TCCGATACATCGCTTTAATTTGAC pLX_317 47.7% 71.5% 70.1% V5 (many diffs) n/a
Download CSV