Transcript: Mouse NM_010275.3

Mus musculus glial cell line derived neurotrophic factor (Gdnf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gdnf (14573)
Length:
4477
CDS:
1007..1729

Additional Resources:

NCBI RefSeq record:
NM_010275.3
NBCI Gene record:
Gdnf (14573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353483 ACAACCTGGTTTACCATATTC pLKO_005 1671 CDS 100% 13.200 18.480 N Gdnf n/a
2 TRCN0000068267 GCTGACCAGTGACTCCAATAT pLKO.1 1231 CDS 100% 13.200 10.560 N Gdnf n/a
3 TRCN0000328481 GGGACTCTAAGATGAAGTTAT pLKO_005 1083 CDS 100% 13.200 10.560 N Gdnf n/a
4 TRCN0000068264 CGGGACTCTAAGATGAAGTTA pLKO.1 1082 CDS 100% 5.625 4.500 N Gdnf n/a
5 TRCN0000328482 AGGAACTGATCTTTCGATATT pLKO_005 1506 CDS 100% 13.200 9.240 N Gdnf n/a
6 TRCN0000328544 CCAATATGCCTGAAGATTATC pLKO_005 1245 CDS 100% 13.200 9.240 N Gdnf n/a
7 TRCN0000068263 CCCTGCTTTCTATCTGCTAAA pLKO.1 3134 3UTR 100% 10.800 7.560 N Gdnf n/a
8 TRCN0000328479 CCTGCTACAGTGCGAAGAAAG pLKO_005 1762 3UTR 100% 10.800 7.560 N Gdnf n/a
9 TRCN0000068265 GCCGAGACAATGTATGACAAA pLKO.1 1547 CDS 100% 4.950 3.465 N Gdnf n/a
10 TRCN0000068266 CCAGAGAATTCCAGAGGGAAA pLKO.1 1391 CDS 100% 0.000 0.000 N Gdnf n/a
11 TRCN0000058826 GAAACCAAGGAGGAACTGATT pLKO.1 1496 CDS 100% 4.950 3.465 N GDNF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00628 pDONR223 100% 78.8% 81.6% None (many diffs) n/a
2 ccsbBroad304_00628 pLX_304 0% 78.8% 81.6% V5 (many diffs) n/a
3 TRCN0000472808 ATGAGAGGAAAGAGCTTGCGGTAG pLX_317 70.5% 78.8% 81.6% V5 (many diffs) n/a
Download CSV