Transcript: Mouse NM_010301.4

Mus musculus guanine nucleotide binding protein, alpha 11 (Gna11), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Mus musculus (mouse)
Gene:
Gna11 (14672)
Length:
3404
CDS:
236..1315

Additional Resources:

NCBI RefSeq record:
NM_010301.4
NBCI Gene record:
Gna11 (14672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010301.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350072 TGGTGGCACTAAGCGAGTATG pLKO_005 921 CDS 100% 10.800 15.120 N Gna11 n/a
2 TRCN0000098129 CTCACACTTGGTCGATTACTT pLKO.1 1090 CDS 100% 5.625 7.875 N Gna11 n/a
3 TRCN0000317740 CTCACACTTGGTCGATTACTT pLKO_005 1090 CDS 100% 5.625 7.875 N Gna11 n/a
4 TRCN0000098128 GCTATCTGACTCGGCTAAGTA pLKO.1 691 CDS 100% 5.625 7.875 N Gna11 n/a
5 TRCN0000350071 CCACAGCCACAAGGCTATTAA pLKO_005 1581 3UTR 100% 15.000 10.500 N Gna11 n/a
6 TRCN0000098126 GCACTCACACTTGGTCGATTA pLKO.1 1087 CDS 100% 10.800 7.560 N Gna11 n/a
7 TRCN0000319620 TCAACGCGGAGATCGAGAAAC pLKO_005 297 CDS 100% 10.800 7.560 N Gna11 n/a
8 TRCN0000036460 GCTCAAGATCCTCTACAAGTA pLKO.1 523 CDS 100% 4.950 3.465 N GNA11 n/a
9 TRCN0000300431 GCTCAAGATCCTCTACAAGTA pLKO_005 523 CDS 100% 4.950 3.465 N GNA11 n/a
10 TRCN0000098125 CCTCTACAAGTATGAGCAGAA pLKO.1 532 CDS 100% 4.050 2.835 N Gna11 n/a
11 TRCN0000098127 CCAGAACATCTTTACCGCCAT pLKO.1 475 CDS 100% 2.160 1.512 N Gna11 n/a
12 TRCN0000319622 TGGTGTACCAGAACATCTTTA pLKO_005 468 CDS 100% 13.200 7.920 N Gna11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010301.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00650 pDONR223 100% 89.7% 98% None (many diffs) n/a
2 ccsbBroad304_00650 pLX_304 0% 89.7% 98% V5 (many diffs) n/a
3 TRCN0000481250 AGCAATGTCGGCCTCTATCAGTAG pLX_317 35.8% 89.7% 98% V5 (many diffs) n/a
Download CSV