Transcript: Mouse NM_010347.4

Mus musculus amino-terminal enhancer of split (Aes), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Aes (14797)
Length:
1488
CDS:
199..792

Additional Resources:

NCBI RefSeq record:
NM_010347.4
NBCI Gene record:
Aes (14797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097716 CTACGGATTGAACATCGAGAT pLKO.1 402 CDS 100% 4.050 5.670 N Aes n/a
2 TRCN0000097715 CCCAGAATGTACACAACGCTA pLKO.1 1013 3UTR 100% 2.640 3.696 N Aes n/a
3 TRCN0000097717 TGACGGAGAGAAGTCGGATTA pLKO.1 771 CDS 100% 10.800 7.560 N Aes n/a
4 TRCN0000097718 AGGCATTACGTCATGTACTAT pLKO.1 373 CDS 100% 5.625 3.938 N Aes n/a
5 TRCN0000097719 CGACTCCTGTGACCGCATCAA pLKO.1 267 CDS 100% 1.650 1.155 N Aes n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00034 pDONR223 100% 63.2% 71.2% None (many diffs) n/a
2 ccsbBroad304_00034 pLX_304 0% 63.2% 71.2% V5 (many diffs) n/a
3 TRCN0000466764 TGTCTCCGGCCTGGGCGCCTTTCA pLX_317 48.8% 63.2% 71.2% V5 (many diffs) n/a
Download CSV