Transcript: Mouse NM_010361.2

Mus musculus glutathione S-transferase, theta 2 (Gstt2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Gstt2 (14872)
Length:
1370
CDS:
596..1330

Additional Resources:

NCBI RefSeq record:
NM_010361.2
NBCI Gene record:
Gstt2 (14872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103440 CCAGGTGAACTGCTTAAACAA pLKO.1 733 CDS 100% 5.625 7.875 N Gstt2 n/a
2 TRCN0000103444 CGTACCGTGGATATACTCAAA pLKO.1 686 CDS 100% 4.950 6.930 N Gstt2 n/a
3 TRCN0000103442 CAGGTGAACTGCTTAAACAAA pLKO.1 734 CDS 100% 5.625 4.500 N Gstt2 n/a
4 TRCN0000103443 CGACAACATCCGTGGTACTTT pLKO.1 904 CDS 100% 5.625 3.938 N Gstt2 n/a
5 TRCN0000103441 GCTCTTGGCTATAACCTGTTT pLKO.1 1127 CDS 100% 4.950 3.465 N Gstt2 n/a
6 TRCN0000163832 CTTCGCCAAGAAGAATGGCAT pLKO.1 652 CDS 100% 2.640 1.584 N GSTT2 n/a
7 TRCN0000162634 CTACATCTTCGCCAAGAAGAA pLKO.1 646 CDS 100% 0.495 0.248 Y GSTT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.