Transcript: Mouse NM_010401.4

Mus musculus histidine ammonia lyase (Hal), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hal (15109)
Length:
2776
CDS:
364..2337

Additional Resources:

NCBI RefSeq record:
NM_010401.4
NBCI Gene record:
Hal (15109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098823 CGCACCGTACATCGAGAAATA pLKO.1 2211 CDS 100% 13.200 18.480 N Hal n/a
2 TRCN0000098820 CAGCCACAATTCCATAGGTTT pLKO.1 2608 3UTR 100% 4.950 6.930 N Hal n/a
3 TRCN0000098824 GCGACGCTACATGAAGAACAA pLKO.1 459 CDS 100% 4.950 6.930 N Hal n/a
4 TRCN0000098821 CGGCAATTAGTGAAAGAAGAA pLKO.1 1754 CDS 100% 4.950 3.960 N Hal n/a
5 TRCN0000098822 GCCAAAGGTTACAGTGGGATT pLKO.1 1018 CDS 100% 4.050 3.240 N Hal n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06350 pDONR223 100% 87.4% 93.9% None (many diffs) n/a
2 ccsbBroad304_06350 pLX_304 0% 87.4% 93.9% V5 (many diffs) n/a
3 TRCN0000471830 AGGAGCATCGCCCTTGGGTCGAAA pLX_317 25% 87.4% 93.9% V5 (many diffs) n/a
Download CSV