Transcript: Mouse NM_010403.2

Mus musculus hydroxyacid oxidase 1, liver (Hao1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hao1 (15112)
Length:
2029
CDS:
21..1133

Additional Resources:

NCBI RefSeq record:
NM_010403.2
NBCI Gene record:
Hao1 (15112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076721 CTATTGTTGTAAAGGGCATTT pLKO.1 715 CDS 100% 10.800 15.120 N Hao1 n/a
2 TRCN0000046130 CGACAAGACATTGGTGAGGAA pLKO.1 1085 CDS 100% 2.640 3.696 N HAO1 n/a
3 TRCN0000450365 AGATATCCTCTGGTGAGATTG pLKO_005 1439 3UTR 100% 10.800 8.640 N Hao1 n/a
4 TRCN0000445301 GATCTGACAGTGCACAATATT pLKO_005 1127 CDS 100% 15.000 10.500 N Hao1 n/a
5 TRCN0000444872 TACTGACCTCACTGTTCATTA pLKO_005 1484 3UTR 100% 13.200 9.240 N Hao1 n/a
6 TRCN0000076722 GCTGATAACATCCAAGCATTT pLKO.1 132 CDS 100% 10.800 7.560 N Hao1 n/a
7 TRCN0000076719 CCACCACAACTCAGGATGAAA pLKO.1 552 CDS 100% 5.625 3.938 N Hao1 n/a
8 TRCN0000076718 GCCCAGAGAAACATGAGGTTT pLKO.1 1578 3UTR 100% 4.950 3.465 N Hao1 n/a
9 TRCN0000076720 GCTGTTAAACATGGTGTGGAT pLKO.1 759 CDS 100% 2.640 1.848 N Hao1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03412 pDONR223 100% 87.2% 89.4% None (many diffs) n/a
2 ccsbBroad304_03412 pLX_304 0% 87.2% 89.4% V5 (many diffs) n/a
3 TRCN0000471719 GGATTGCCTGATCACACAGGATAC pLX_317 38.3% 87.2% 89.4% V5 (many diffs) n/a
Download CSV