Transcript: Mouse NM_010459.7

Mus musculus homeobox B4 (Hoxb4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hoxb4 (15412)
Length:
2566
CDS:
504..1256

Additional Resources:

NCBI RefSeq record:
NM_010459.7
NBCI Gene record:
Hoxb4 (15412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010459.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415041 GTTCACGTGAGCACGGTAAAC pLKO_005 942 CDS 100% 10.800 15.120 N Hoxb4 n/a
2 TRCN0000015717 CGATTACCTACCCAGCGACCA pLKO.1 581 CDS 100% 0.720 1.008 N HOXB4 n/a
3 TRCN0000415826 TGGATCCAGGCTTCATCTTTA pLKO_005 1654 3UTR 100% 13.200 10.560 N Hoxb4 n/a
4 TRCN0000423153 GGGTAGGGAAGCCTTATTTAT pLKO_005 1411 3UTR 100% 15.000 10.500 N Hoxb4 n/a
5 TRCN0000015715 AGTTCACGTGAGCACGGTAAA pLKO.1 941 CDS 100% 10.800 7.560 N HOXB4 n/a
6 TRCN0000421358 CCTCGACACTTGGCTAACAAA pLKO_005 1756 3UTR 100% 5.625 3.938 N Hoxb4 n/a
7 TRCN0000096060 AGGAGTATTCACAGAGCGATT pLKO.1 565 CDS 100% 4.050 2.835 N Hoxb4 n/a
8 TRCN0000096059 CCTCACTTTATCTATAAGGAA pLKO.1 1374 3UTR 100% 3.000 2.100 N Hoxb4 n/a
9 TRCN0000096063 GTATTCACAGAGCGATTACCT pLKO.1 569 CDS 100% 3.000 2.100 N Hoxb4 n/a
10 TRCN0000015716 CCGTCCCACTCCGCGTGCAAA pLKO.1 891 CDS 100% 0.000 0.000 N HOXB4 n/a
11 TRCN0000096062 GAGAAGGAGTTTCACTACAAT pLKO.1 1032 CDS 100% 5.625 3.375 N Hoxb4 n/a
12 TRCN0000367992 TTCCAGAATCGGCGCATGAAG pLKO_005 1128 CDS 100% 4.950 2.475 Y Hoxa7 n/a
13 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1115 CDS 100% 4.050 2.025 Y Hoxa3 n/a
14 TRCN0000019937 CCCTCCGTGCGAGGAGTATTT pLKO.1 554 CDS 100% 4.400 3.080 N HOXD4 n/a
15 TRCN0000353571 CCTCCGTGCGAGGAGTATTTG pLKO_005 555 CDS 100% 4.400 2.640 N HOXD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010459.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.