Transcript: Mouse NM_010461.2

Mus musculus homeobox B8 (Hoxb8), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Hoxb8 (15416)
Length:
2645
CDS:
1059..1790

Additional Resources:

NCBI RefSeq record:
NM_010461.2
NBCI Gene record:
Hoxb8 (15416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304443 TGCCTATTCACGCCGTAATTC pLKO_005 2224 3UTR 100% 13.200 18.480 N Hoxb8 n/a
2 TRCN0000016019 GAGTTCCTATTTAATCCCTAT pLKO.1 1548 CDS 100% 4.050 5.670 N HOXB8 n/a
3 TRCN0000016018 CGCTAGTGGTAGTATCTCGTA pLKO.1 1953 3UTR 100% 2.640 3.696 N HOXB8 n/a
4 TRCN0000285121 CGCTAGTGGTAGTATCTCGTA pLKO_005 1953 3UTR 100% 2.640 3.696 N HOXB8 n/a
5 TRCN0000070879 GACAAGTTTCCCAGCAGTAAA pLKO.1 1680 CDS 100% 13.200 10.560 N Hoxb8 n/a
6 TRCN0000316044 GACAAGTTTCCCAGCAGTAAA pLKO_005 1680 CDS 100% 13.200 10.560 N Hoxb8 n/a
7 TRCN0000070882 CGGCAACTTCTACGGCTACGA pLKO.1 1304 CDS 100% 0.880 0.704 N Hoxb8 n/a
8 TRCN0000016020 CCAATTATTATGACTGCGGCT pLKO.1 1120 CDS 100% 0.540 0.432 N HOXB8 n/a
9 TRCN0000070880 GTTCCTATTTAATCCCTATCT pLKO.1 1550 CDS 100% 4.950 3.465 N Hoxb8 n/a
10 TRCN0000349142 GTTCCTATTTAATCCCTATCT pLKO_005 1550 CDS 100% 4.950 3.465 N Hoxb8 n/a
11 TRCN0000070878 CCCTTCGCAAATCCAGGAGTT pLKO.1 1208 CDS 100% 4.050 2.835 N Hoxb8 n/a
12 TRCN0000315975 CCCTTCGCAAATCCAGGAGTT pLKO_005 1208 CDS 100% 4.050 2.835 N Hoxb8 n/a
13 TRCN0000304444 CAAGCGGAGGATCGAGGTATC pLKO_005 1577 CDS 100% 2.000 1.400 N Hoxb8 n/a
14 TRCN0000070881 CGATGCGCAGAAGGGTGACAA pLKO.1 1763 CDS 100% 1.650 1.155 N Hoxb8 n/a
15 TRCN0000273964 AGTACGCAGACTGCAAGCTTG pLKO_005 1375 CDS 100% 4.050 5.670 N HOXB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.