Transcript: Mouse NM_010570.4

Mus musculus insulin receptor substrate 1 (Irs1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Irs1 (16367)
Length:
9163
CDS:
947..4642

Additional Resources:

NCBI RefSeq record:
NM_010570.4
NBCI Gene record:
Irs1 (16367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244225 GACGCTCCAGTGAGGATTTAA pLKO_005 4572 CDS 100% 15.000 21.000 N Irs1 n/a
2 TRCN0000238266 GGTGATAATGATCCCATATTT pLKO_005 7853 3UTR 100% 15.000 21.000 N Irs1 n/a
3 TRCN0000105880 CGGAACAATTAGTGTGCATAA pLKO.1 4883 3UTR 100% 10.800 15.120 N Irs1 n/a
4 TRCN0000238267 TGGTTCTAGTCCCTGCGATTT pLKO_005 2224 CDS 100% 10.800 15.120 N Irs1 n/a
5 TRCN0000105881 CGAGACGAACACTTTGCCATT pLKO.1 1211 CDS 100% 4.050 5.670 N Irs1 n/a
6 TRCN0000238268 TACCGCAACTGCCGAAGATTC pLKO_005 3331 CDS 100% 0.000 0.000 N Irs1 n/a
7 TRCN0000105883 CGGTCCTCTCTTACTACTCAT pLKO.1 3210 CDS 100% 4.950 3.960 N Irs1 n/a
8 TRCN0000238269 GGAGGAGCTGAGCAATTATAT pLKO_005 2308 CDS 100% 15.000 10.500 N Irs1 n/a
9 TRCN0000105884 CCACACTGATGATGGCTATAT pLKO.1 2752 CDS 100% 13.200 9.240 N Irs1 n/a
10 TRCN0000105882 CCCAGGAGAATATGTGAATAT pLKO.1 3607 CDS 100% 13.200 9.240 N Irs1 n/a
11 TRCN0000009844 CAGAATGAAGACCTAAATGAC pLKO.1 4661 3UTR 100% 4.950 2.970 N IRS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00882 pDONR223 100% 85% 89.2% None (many diffs) n/a
2 ccsbBroad304_00882 pLX_304 15.2% 85% 89.2% V5 (many diffs) n/a
3 TRCN0000472387 CGGGCCTTGCAACTATCGGTTGCG pLX_317 6% 85% 89.2% V5 (many diffs) n/a
Download CSV