Transcript: Mouse NM_010608.2

Mus musculus potassium channel, subfamily K, member 3 (Kcnk3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kcnk3 (16527)
Length:
3810
CDS:
148..1377

Additional Resources:

NCBI RefSeq record:
NM_010608.2
NBCI Gene record:
Kcnk3 (16527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069950 CTGGTACAAGAGCCGCGAGAA pLKO.1 1131 CDS 100% 1.350 1.890 N Kcnk3 n/a
2 TRCN0000069948 TGGACTTTCTTCCAGGCCTAT pLKO.1 697 CDS 100% 4.050 2.835 N Kcnk3 n/a
3 TRCN0000069949 CATCAACACCTTCGTGAGGTA pLKO.1 540 CDS 100% 2.640 1.848 N Kcnk3 n/a
4 TRCN0000070055 CATCGTGTGCACCTTCACCTA pLKO.1 180 CDS 100% 2.640 1.848 N LOC384294 n/a
5 TRCN0000069951 CGGAGGCAAGGTGTTCTGCAT pLKO.1 459 CDS 100% 0.880 0.616 N Kcnk3 n/a
6 TRCN0000069952 GCCGAGGACGAGAAGCGTGAT pLKO.1 898 CDS 100% 0.000 0.000 N Kcnk3 n/a
7 TRCN0000070054 GCCGGAGATGATCGAGCGGCA pLKO.1 243 CDS 100% 0.000 0.000 N LOC384294 n/a
8 TRCN0000043750 GCTGCGCCTCAAGCCGCACAA pLKO.1 345 CDS 100% 0.000 0.000 N KCNK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.