Transcript: Mouse NM_010628.3

Mus musculus kinesin family member 9 (Kif9), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kif9 (16578)
Length:
2744
CDS:
132..2504

Additional Resources:

NCBI RefSeq record:
NM_010628.3
NBCI Gene record:
Kif9 (16578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090699 CGCAGGAAGTACACTCTCATA pLKO.1 1452 CDS 100% 4.950 6.930 N Kif9 n/a
2 TRCN0000436695 TAGGTGAGCCCGATGGACAAA pLKO_005 1543 CDS 100% 4.950 6.930 N Kif9 n/a
3 TRCN0000422347 ACAGATCAGAAGCACAATTAT pLKO_005 2442 CDS 100% 15.000 10.500 N Kif9 n/a
4 TRCN0000421981 TCTGTCAAACCTGGGAAGAAA pLKO_005 1590 CDS 100% 5.625 3.938 N Kif9 n/a
5 TRCN0000090702 CCTACTGATGACTTTGCTCAT pLKO.1 174 CDS 100% 4.050 2.835 N Kif9 n/a
6 TRCN0000415426 GGAAGCTGCTAAACCACATGC pLKO_005 2548 3UTR 100% 4.050 2.835 N Kif9 n/a
7 TRCN0000090701 GCAAGGACTTTGATGTGGCTT pLKO.1 1687 CDS 100% 2.640 1.848 N Kif9 n/a
8 TRCN0000090700 CCGTGTTTCCTACCTGGAAAT pLKO.1 542 CDS 100% 1.080 0.756 N Kif9 n/a
9 TRCN0000090698 CCAAACCCAGAGAACACACAA pLKO.1 2602 3UTR 100% 4.950 2.970 N Kif9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08840 pDONR223 100% 86.9% 88.8% None (many diffs) n/a
2 ccsbBroad304_08840 pLX_304 0% 86.9% 88.8% V5 (many diffs) n/a
3 TRCN0000470800 CATAACCGTGCCTCCACCAATGCG pLX_317 21.5% 86.9% 88.8% V5 (many diffs) n/a
Download CSV