Transcript: Mouse NM_010753.2

Mus musculus Max dimerization protein 4 (Mxd4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mxd4 (17122)
Length:
1194
CDS:
138..767

Additional Resources:

NCBI RefSeq record:
NM_010753.2
NBCI Gene record:
Mxd4 (17122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084705 CTTCACACAACGAACTAGAAA pLKO.1 304 CDS 100% 5.625 7.875 N Mxd4 n/a
2 TRCN0000084704 GCGTGCTAAGATGCACATCAA pLKO.1 425 CDS 100% 4.950 6.930 N Mxd4 n/a
3 TRCN0000084707 TCGCTTCCTAAAGAGACGTTT pLKO.1 506 CDS 100% 4.950 6.930 N Mxd4 n/a
4 TRCN0000315937 TCGCTTCCTAAAGAGACGTTT pLKO_005 506 CDS 100% 4.950 6.930 N Mxd4 n/a
5 TRCN0000311001 TTCGTAGGCTCCATGTCCTTT pLKO_005 761 CDS 100% 4.950 6.930 N Mxd4 n/a
6 TRCN0000311000 CAGAGCAAGAGGTGGATATAG pLKO_005 601 CDS 100% 13.200 9.240 N Mxd4 n/a
7 TRCN0000084706 ACGAGCTAAACTCAGGCTCTA pLKO.1 332 CDS 100% 4.050 2.835 N Mxd4 n/a
8 TRCN0000311004 TGATGCCGATGACCACTACAG pLKO_005 671 CDS 100% 4.050 2.835 N Mxd4 n/a
9 TRCN0000084703 CCCACAATCTGTTCTCAGATT pLKO.1 1031 3UTR 100% 0.495 0.297 N Mxd4 n/a
10 TRCN0000316011 CCCACAATCTGTTCTCAGATT pLKO_005 1031 3UTR 100% 0.495 0.297 N Mxd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11528 pDONR223 100% 25.5% 24.8% None (many diffs) n/a
2 ccsbBroad304_11528 pLX_304 0% 25.5% 24.8% V5 (many diffs) n/a
3 TRCN0000472142 CTGTCATCTCTGGACGTGGCCGCT pLX_317 100% 25.5% 24.8% V5 (many diffs) n/a
Download CSV