Transcript: Mouse NM_010762.5

Mus musculus myelin and lymphocyte protein, T cell differentiation protein (Mal), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mal (17153)
Length:
2792
CDS:
563..1024

Additional Resources:

NCBI RefSeq record:
NM_010762.5
NBCI Gene record:
Mal (17153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010762.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100668 CCTGATGATCTTGTACATAAT pLKO.1 766 CDS 100% 13.200 9.240 N Mal n/a
2 TRCN0000100669 CAATGTTTGATGGCTTTACTT pLKO.1 897 CDS 100% 5.625 3.938 N Mal n/a
3 TRCN0000100667 GCCACCATCTCAATGTTTGAT pLKO.1 887 CDS 100% 5.625 3.938 N Mal n/a
4 TRCN0000100665 GCTCCTTTGAAATGCTTCATT pLKO.1 1516 3UTR 100% 5.625 3.938 N Mal n/a
5 TRCN0000100666 CCTTAATCAGATGGAAGTCTT pLKO.1 999 CDS 100% 4.950 3.465 N Mal n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010762.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00971 pDONR223 100% 85.8% 86.9% None (many diffs) n/a
2 ccsbBroad304_00971 pLX_304 0% 85.8% 86.9% V5 (many diffs) n/a
3 TRCN0000473853 AGATTTAGCGGCTTCATCCCCAAA pLX_317 100% 85.8% 86.9% V5 (many diffs) n/a
Download CSV