Transcript: Mouse NM_010784.5

Mus musculus midkine (Mdk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mdk (17242)
Length:
1077
CDS:
370..792

Additional Resources:

NCBI RefSeq record:
NM_010784.5
NBCI Gene record:
Mdk (17242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089104 GCCGACTGCAAATACAAGTTT pLKO.1 604 CDS 100% 5.625 7.875 N Mdk n/a
2 TRCN0000089105 CACCTCCAAGACCAAGTCAAA pLKO.1 738 CDS 100% 4.950 3.465 N Mdk n/a
3 TRCN0000089103 CCCAAGATATAACCCACCAGT pLKO.1 857 3UTR 100% 2.640 1.848 N Mdk n/a
4 TRCN0000089107 CCAAGTCAAAGACCAAAGCCA pLKO.1 749 CDS 100% 0.750 0.525 N Mdk n/a
5 TRCN0000089106 CCTGCAACTGGAAGAAGGAAT pLKO.1 578 CDS 100% 4.950 2.970 N Mdk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00992 pDONR223 100% 87.6% 86% None (many diffs) n/a
2 ccsbBroad304_00992 pLX_304 0% 87.6% 86% V5 (many diffs) n/a
3 TRCN0000465551 CCTATCATCCAGACGTTTAAGGCG pLX_317 85.9% 87.6% 86% V5 (many diffs) n/a
Download CSV