Transcript: Mouse NM_010814.2

Mus musculus myelin oligodendrocyte glycoprotein (Mog), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mog (17441)
Length:
1725
CDS:
200..943

Additional Resources:

NCBI RefSeq record:
NM_010814.2
NBCI Gene record:
Mog (17441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106612 CTCCAGTTGTCATGCAGCTAT pLKO.1 263 CDS 100% 4.950 3.960 N Mog n/a
2 TRCN0000106610 GCAGGACAATTCAGAGTGATA pLKO.1 284 CDS 100% 4.950 3.960 N Mog n/a
3 TRCN0000106614 GAGGCAGCAATGGAGTTGAAA pLKO.1 608 CDS 100% 5.625 3.938 N Mog n/a
4 TRCN0000106613 CGAAATGGCAAGGACCAAGAT pLKO.1 440 CDS 100% 4.950 3.465 N Mog n/a
5 TRCN0000106611 GCAGAAGTAGAGAATCTCCAT pLKO.1 761 CDS 100% 2.640 1.848 N Mog n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10974 pDONR223 100% 70.1% 71.6% None (many diffs) n/a
2 TRCN0000480215 CGTAATGACCTGCTCAATACACAG pLX_317 48.2% 70.1% 71.6% V5 (many diffs) n/a
Download CSV