Transcript: Mouse NM_010856.4

Mus musculus myosin, heavy polypeptide 6, cardiac muscle, alpha (Myh6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myh6 (17888)
Length:
6015
CDS:
139..5955

Additional Resources:

NCBI RefSeq record:
NM_010856.4
NBCI Gene record:
Myh6 (17888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220539 GCGGAACAAGACAACCTCAAT pLKO.1 2821 CDS 100% 4.950 6.930 N Myh6 n/a
2 TRCN0000220540 CGCATTGAGTTCAAGAAGATA pLKO.1 2536 CDS 100% 5.625 4.500 N Myh6 n/a
3 TRCN0000220541 GCTACACTCTTCTCTACCTAT pLKO.1 1993 CDS 100% 4.950 3.960 N Myh6 n/a
4 TRCN0000220543 GCTGACCAAGTCCAAAGTCAA pLKO.1 3201 CDS 100% 4.950 3.465 N Myh6 n/a
5 TRCN0000083535 GAGTTCAAGAAGATAGTGGAA pLKO.1 2542 CDS 100% 2.640 1.848 N MYH6 n/a
6 TRCN0000220542 GCTGGATGAAATCATTGCCAA pLKO.1 3096 CDS 100% 2.640 1.848 N Myh6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15503 pDONR223 0% 87.6% 92% None (many diffs) n/a
2 ccsbBroad304_15503 pLX_304 0% 87.6% 92% V5 (many diffs) n/a
3 TRCN0000466427 GTATGGACTATCGCGATATGCGCC pLX_317 6.9% 87.6% 92% V5 (many diffs) n/a
4 TRCN0000470090 CGCTCATCACTAGCCCGGCCCGTT pLX_317 6.9% 87.5% 91.7% V5 (many diffs) n/a
Download CSV