Transcript: Mouse NM_010859.2

Mus musculus myosin, light polypeptide 3 (Myl3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Myl3 (17897)
Length:
898
CDS:
65..679

Additional Resources:

NCBI RefSeq record:
NM_010859.2
NBCI Gene record:
Myl3 (17897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091181 CAATTCCAAGATGATGGATTT pLKO.1 403 CDS 100% 10.800 7.560 N Myl3 n/a
2 TRCN0000091180 TGATGCCTCCAAGATTAAGAT pLKO.1 202 CDS 100% 5.625 3.938 N Myl3 n/a
3 TRCN0000091179 CTCCAAGATTAAGATCGAGTT pLKO.1 208 CDS 100% 4.050 2.835 N Myl3 n/a
4 TRCN0000091182 GAGAAACTGATGGCTGGTCAA pLKO.1 599 CDS 100% 4.050 2.835 N Myl3 n/a
5 TRCN0000091178 CAACCATGATGCTGACACCAT pLKO.1 716 3UTR 100% 2.640 1.848 N Myl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13907 pDONR223 100% 86.9% 1.9% None (many diffs) n/a
2 ccsbBroad304_13907 pLX_304 0% 86.9% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468865 TAATTGATAGTTTATCCTCCCACC pLX_317 74.7% 86.9% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV