Transcript: Mouse NM_010879.3

Mus musculus non-catalytic region of tyrosine kinase adaptor protein 2 (Nck2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Nck2 (17974)
Length:
2789
CDS:
457..1599

Additional Resources:

NCBI RefSeq record:
NM_010879.3
NBCI Gene record:
Nck2 (17974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097164 CGAGGCTGTATGTAGTGAATA pLKO.1 1951 3UTR 100% 13.200 9.240 N Nck2 n/a
2 TRCN0000097167 AGGGAGAAACAAGCACTTCAA pLKO.1 1437 CDS 100% 4.950 3.465 N Nck2 n/a
3 TRCN0000097165 CCGCATCTATGACCTCAACAT pLKO.1 777 CDS 100% 4.950 3.465 N Nck2 n/a
4 TRCN0000097168 GTGATTGAGAAGCCGGAGAAT pLKO.1 1126 CDS 100% 4.950 3.465 N Nck2 n/a
5 TRCN0000097166 CCCTGAATGGTGGAAATGCAA pLKO.1 1149 CDS 100% 3.000 2.100 N Nck2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01928 pDONR223 100% 88.5% 96% None (many diffs) n/a
2 ccsbBroad304_01928 pLX_304 0% 88.5% 96% V5 (many diffs) n/a
3 TRCN0000466009 CCAACGCTTTGACCTTTGCAGGAG pLX_317 28.3% 88.5% 96% V5 (many diffs) n/a
Download CSV