Transcript: Mouse NM_010881.2

Mus musculus nuclear receptor coactivator 1 (Ncoa1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ncoa1 (17977)
Length:
7346
CDS:
713..4930

Additional Resources:

NCBI RefSeq record:
NM_010881.2
NBCI Gene record:
Ncoa1 (17977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095569 CAGCAGCTACTGACTGAATAA pLKO.1 5091 3UTR 100% 13.200 18.480 N Ncoa1 n/a
2 TRCN0000095571 CGCCGAAATAGCCATACATTT pLKO.1 1277 CDS 100% 13.200 18.480 N Ncoa1 n/a
3 TRCN0000095570 CCCACCAAACTATGGTACAAA pLKO.1 4237 CDS 100% 5.625 7.875 N Ncoa1 n/a
4 TRCN0000095573 CCGAATAAATCCCTCAGTCAA pLKO.1 1864 CDS 100% 4.950 6.930 N Ncoa1 n/a
5 TRCN0000433008 TATGAATGAAGGACCCAATAA pLKO_005 2344 CDS 100% 13.200 9.240 N Ncoa1 n/a
6 TRCN0000429698 AGTAGATCAGATACAGCTAAT pLKO_005 931 CDS 100% 10.800 7.560 N Ncoa1 n/a
7 TRCN0000095572 CCTATTCAAATATCCCAGTAA pLKO.1 2310 CDS 100% 4.950 3.465 N Ncoa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473147 TCTATCCCCGTTAGTGATATAACT pLX_317 11.7% 86.1% 88.5% V5 (many diffs) n/a
Download CSV