Transcript: Mouse NM_010932.2

Mus musculus prepronociceptin (Pnoc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pnoc (18155)
Length:
2157
CDS:
360..923

Additional Resources:

NCBI RefSeq record:
NM_010932.2
NBCI Gene record:
Pnoc (18155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106567 GAAGCGGTTCAGTGAGTTTAT pLKO.1 830 CDS 100% 13.200 18.480 N Pnoc n/a
2 TRCN0000106565 CCCAGCAGAATCTTATACATT pLKO.1 1818 3UTR 100% 5.625 4.500 N Pnoc n/a
3 TRCN0000106568 TCCAGACAGCTTCAACTTAAA pLKO.1 464 CDS 100% 13.200 9.240 N Pnoc n/a
4 TRCN0000155758 CAGAAGCGGTTCAGTGAGTTT pLKO.1 828 CDS 100% 4.950 3.465 N PNOC n/a
5 TRCN0000106569 CTCTGGACTGTATGCACCAAA pLKO.1 528 CDS 100% 4.950 3.465 N Pnoc n/a
6 TRCN0000153020 GCACCAGAATGGTAATGTGTA pLKO.1 902 CDS 100% 4.950 3.465 N PNOC n/a
7 TRCN0000106566 CCAGTGTGAAGAGAAGGTCTT pLKO.1 497 CDS 100% 4.050 2.835 N Pnoc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01226 pDONR223 100% 81.2% 78.6% None (many diffs) n/a
2 ccsbBroad304_01226 pLX_304 0% 81.2% 78.6% V5 (many diffs) n/a
3 TRCN0000468662 GGACCCTTACTTCTTAAAGTAAAT pLX_317 62.4% 81.2% 78.6% V5 (many diffs) n/a
Download CSV