Transcript: Mouse NM_011051.3

Mus musculus programmed cell death 6 (Pdcd6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pdcd6 (18570)
Length:
1524
CDS:
120..695

Additional Resources:

NCBI RefSeq record:
NM_011051.3
NBCI Gene record:
Pdcd6 (18570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104814 CAGGTGTCTTATGAGCAATAT pLKO.1 648 CDS 100% 13.200 9.240 N Pdcd6 n/a
2 TRCN0000104811 GCAGAGGTTGACAGACATATT pLKO.1 593 CDS 100% 13.200 9.240 N Pdcd6 n/a
3 TRCN0000104813 CTGGTGTGAACTTCAGTGAAT pLKO.1 352 CDS 100% 4.950 3.465 N Pdcd6 n/a
4 TRCN0000104810 GCCGTTTGTTACACTACTCTA pLKO.1 1192 3UTR 100% 4.950 3.465 N Pdcd6 n/a
5 TRCN0000104812 CCAATGGTACATGGACTCCAT pLKO.1 277 CDS 100% 2.640 1.848 N Pdcd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479193 CAACGACCCCACCCCTTGTTCCTG pLX_317 82.8% 86.9% 98.9% V5 (many diffs) n/a
2 ccsbBroadEn_07533 pDONR223 100% 86.7% 98.4% None (many diffs) n/a
3 ccsbBroad304_07533 pLX_304 0% 86.7% 98.4% V5 (many diffs) n/a
Download CSV