Transcript: Mouse NM_011073.3

Mus musculus perforin 1 (pore forming protein) (Prf1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Prf1 (18646)
Length:
2054
CDS:
56..1720

Additional Resources:

NCBI RefSeq record:
NM_011073.3
NBCI Gene record:
Prf1 (18646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415264 ACAGGCTATCAGCCATTATAT pLKO_005 1135 CDS 100% 15.000 12.000 N Prf1 n/a
2 TRCN0000421512 GCATAAGAGTAGCCATGATTC pLKO_005 1207 CDS 100% 10.800 8.640 N Prf1 n/a
3 TRCN0000077206 CCACTCCAAGGTAGCCAATTT pLKO.1 502 CDS 100% 13.200 9.240 N Prf1 n/a
4 TRCN0000077205 CGGTGTCGTGTGGAACAATAA pLKO.1 1402 CDS 100% 13.200 9.240 N Prf1 n/a
5 TRCN0000426440 AGCTACTGATGCCTACCTAAA pLKO_005 1351 CDS 100% 10.800 7.560 N Prf1 n/a
6 TRCN0000429202 AGCTCACACTGCCAGCGTAAT pLKO_005 347 CDS 100% 10.800 7.560 N Prf1 n/a
7 TRCN0000433560 TGTGAGTGCCAGGATTCAAAG pLKO_005 1235 CDS 100% 10.800 7.560 N Prf1 n/a
8 TRCN0000077203 CTATGCATAGAGAGGCCACTA pLKO.1 1916 3UTR 100% 4.050 2.835 N Prf1 n/a
9 TRCN0000077207 AGGGTGAAATTCTCCTACCAT pLKO.1 1598 CDS 100% 3.000 2.100 N Prf1 n/a
10 TRCN0000077204 GCCCATTTGGTGGTAAGCAAT pLKO.1 1295 CDS 100% 4.950 2.970 N Prf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.