Transcript: Mouse NM_011076.2

Mus musculus ATP-binding cassette, sub-family B (MDR/TAP), member 1A (Abcb1a), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Abcb1a (18671)
Length:
4977
CDS:
138..3968

Additional Resources:

NCBI RefSeq record:
NM_011076.2
NBCI Gene record:
Abcb1a (18671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111080 GCACACATTAACCAACGACTA pLKO.1 4741 3UTR 100% 4.050 5.670 N Abcb1a n/a
2 TRCN0000337771 AGTGTAGGAAACGTCTCTAAA pLKO_005 375 CDS 100% 13.200 10.560 N Abcb1a n/a
3 TRCN0000111081 GCCATAATAAATGGAGGCTTA pLKO.1 2277 CDS 100% 4.050 3.240 N Abcb1a n/a
4 TRCN0000337772 GTATATTCTGTGCCATAATAA pLKO_005 2266 CDS 100% 15.000 10.500 N Abcb1a n/a
5 TRCN0000337845 TGAAACTGAGCATTCATATTT pLKO_005 4332 3UTR 100% 15.000 10.500 N Abcb1a n/a
6 TRCN0000337844 GACCACGTACGCCTACTATTA pLKO_005 458 CDS 100% 13.200 9.240 N Abcb1a n/a
7 TRCN0000337846 TGGACTGTCAGCTGGTATTTG pLKO_005 800 CDS 100% 13.200 9.240 N Abcb1a n/a
8 TRCN0000111083 CCCACTTATGATGCTGATCTT pLKO.1 329 CDS 100% 4.950 3.465 N Abcb1a n/a
9 TRCN0000111082 GCCGAATATGTTGGAAGGAAA pLKO.1 3206 CDS 100% 4.950 3.465 N Abcb1a n/a
10 TRCN0000111084 TCTGTTAGTATTCTCAGCTAT pLKO.1 3047 CDS 100% 4.950 3.465 N Abcb1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488873 GGAGCCTAGACGATTTGACCACTA pLX_317 8.5% 85.7% 87.1% V5 (many diffs) n/a
Download CSV