Transcript: Mouse NM_011077.2

Mus musculus phosphate regulating endopeptidase homolog, X-linked (Phex), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Phex (18675)
Length:
6265
CDS:
531..2780

Additional Resources:

NCBI RefSeq record:
NM_011077.2
NBCI Gene record:
Phex (18675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031194 CGGTGCTTAGACTGGAAATTA pLKO.1 1348 CDS 100% 15.000 21.000 N Phex n/a
2 TRCN0000434927 TAACCAGTATAGCAACTATTA pLKO_005 2387 CDS 100% 13.200 9.240 N PHEX n/a
3 TRCN0000031196 CCTCCACAATTTAGGGTCAAT pLKO.1 2664 CDS 100% 4.950 3.465 N Phex n/a
4 TRCN0000031198 CCTCTACTCATCCTGCATGAA pLKO.1 941 CDS 100% 4.950 3.465 N Phex n/a
5 TRCN0000031197 CCTGATGACAAGGCATCCAAT pLKO.1 1158 CDS 100% 4.950 3.465 N Phex n/a
6 TRCN0000047090 GCTGAGATAATGATTCCACAT pLKO.1 1374 CDS 100% 4.050 2.835 N PHEX n/a
7 TRCN0000031195 CCATGAATTTACACATGGATT pLKO.1 2267 CDS 100% 0.495 0.347 N Phex n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01188 pDONR223 100% 91.3% 95.9% None (many diffs) n/a
2 ccsbBroad304_01188 pLX_304 0% 91.3% 95.9% V5 (many diffs) n/a
3 TRCN0000477264 GAGACAGACCGACAGGTCTTATAT pLX_317 10.2% 91.3% 95.9% V5 (many diffs) n/a
Download CSV