Transcript: Mouse NM_011124.4

Mus musculus chemokine (C-C motif) ligand 21A (serine) (Ccl21a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ccl21a (18829)
Length:
868
CDS:
74..475

Additional Resources:

NCBI RefSeq record:
NM_011124.4
NBCI Gene record:
Ccl21a (18829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011124.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067789 AGGAAGCAAGAACCAAGTTTA pLKO.1 218 CDS 100% 13.200 6.600 Y Ccl21a n/a
2 TRCN0000067791 ACCTCTAAGTCTGGAAAGAAA pLKO.1 398 CDS 100% 5.625 2.813 Y Ccl21a n/a
3 TRCN0000067752 AGCACTCTAAGCCTGAGCTAT pLKO.1 276 CDS 100% 4.950 2.475 Y Ccl21c n/a
4 TRCN0000067749 CCTTAAGTACAGCCAGAAGAA pLKO.1 169 CDS 100% 4.950 2.475 Y Ccl21c n/a
5 TRCN0000067748 CGAGGCTATAGGAAGCAAGAA pLKO.1 209 CDS 100% 4.950 2.475 Y Ccl21c n/a
6 TRCN0000089509 CTGAACAGACACAGCCCTCAA pLKO.1 447 CDS 100% 4.050 2.025 Y Ccl21b n/a
7 TRCN0000067788 CTAAGTCTGGAAAGAAAGGAA pLKO.1 402 CDS 100% 3.000 1.500 Y Ccl21a n/a
8 TRCN0000067751 GCTGCAAGAGAACTGAACAGA pLKO.1 435 CDS 100% 3.000 1.500 Y Ccl21c n/a
9 TRCN0000067792 ACCAAGTTTAGGCTGTCCCAT pLKO.1 229 CDS 100% 2.640 1.320 Y Ccl21a n/a
10 TRCN0000089510 CTAAGCCTGAGCTATGTGCAA pLKO.1 282 CDS 100% 2.640 1.320 Y Ccl21b n/a
11 TRCN0000067790 CTACAGTATTGTCCGAGGCTA pLKO.1 196 CDS 100% 2.640 1.320 Y Ccl21a n/a
12 TRCN0000067750 CTATGTGCAAACCCTGAGGAA pLKO.1 293 CDS 100% 2.640 1.320 Y Ccl21c n/a
13 TRCN0000089511 CTGGAAAGAAAGGAAAGGGCT pLKO.1 408 CDS 100% 0.660 0.330 Y Ccl21b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011124.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.