Transcript: Mouse NM_011127.2

Mus musculus paired related homeobox 1 (Prrx1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prrx1 (18933)
Length:
4911
CDS:
1016..1753

Additional Resources:

NCBI RefSeq record:
NM_011127.2
NBCI Gene record:
Prrx1 (18933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349760 CTATCCATGCTTAGCTAATTA pLKO_005 2005 3UTR 100% 15.000 21.000 N Prrx1 n/a
2 TRCN0000312788 ACAGCGCCATGGCTACTTATT pLKO_005 1611 CDS 100% 13.200 18.480 N Prrx1 n/a
3 TRCN0000349761 GCTCCCAGACCAACCGATTAT pLKO_005 1565 CDS 100% 13.200 18.480 N Prrx1 n/a
4 TRCN0000070708 GCGGAGAAACAGGACAACATT pLKO.1 1297 CDS 100% 5.625 7.875 N Prrx1 n/a
5 TRCN0000070712 GCTGTGGAGCAACCCATCGTA pLKO.1 1535 CDS 100% 1.000 1.400 N Prrx1 n/a
6 TRCN0000349402 GCTGTGGAGCAACCCATCGTA pLKO_005 1535 CDS 100% 1.000 1.400 N Prrx1 n/a
7 TRCN0000070711 CGAGCCATGCTGGCCAATAAA pLKO.1 1475 CDS 100% 15.000 10.500 N Prrx1 n/a
8 TRCN0000311852 CGAGCCATGCTGGCCAATAAA pLKO_005 1475 CDS 100% 15.000 10.500 N Prrx1 n/a
9 TRCN0000070709 GCAGGACAATGACCAGTTGAA pLKO.1 1249 CDS 100% 4.950 3.465 N Prrx1 n/a
10 TRCN0000070710 CGTGTCTTTGAGCGGACACAT pLKO.1 1346 CDS 100% 0.495 0.347 N Prrx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.