Transcript: Mouse NM_011133.2

Mus musculus polymerase (DNA directed), epsilon 2 (p59 subunit) (Pole2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pole2 (18974)
Length:
1695
CDS:
27..1610

Additional Resources:

NCBI RefSeq record:
NM_011133.2
NBCI Gene record:
Pole2 (18974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120321 AGCTGTATCTTGAACGCTATA pLKO.1 409 CDS 100% 10.800 15.120 N Pole2 n/a
2 TRCN0000314278 AGCTGTATCTTGAACGCTATA pLKO_005 409 CDS 100% 10.800 15.120 N Pole2 n/a
3 TRCN0000120318 CCGTGAAGACTTAGTGAATAA pLKO.1 1271 CDS 100% 13.200 10.560 N Pole2 n/a
4 TRCN0000314279 CCGTGAAGACTTAGTGAATAA pLKO_005 1271 CDS 100% 13.200 10.560 N Pole2 n/a
5 TRCN0000120320 CCTCTATCCATGACTAATCAT pLKO.1 348 CDS 100% 5.625 3.938 N Pole2 n/a
6 TRCN0000120317 GCCACCAAGTATCTGACTGAA pLKO.1 99 CDS 100% 4.950 3.465 N Pole2 n/a
7 TRCN0000314277 GCCACCAAGTATCTGACTGAA pLKO_005 99 CDS 100% 4.950 3.465 N Pole2 n/a
8 TRCN0000120319 GCTGGTCATTGCAGACAAGTA pLKO.1 1457 CDS 100% 4.950 3.465 N Pole2 n/a
9 TRCN0000314375 GCTGGTCATTGCAGACAAGTA pLKO_005 1457 CDS 100% 4.950 3.465 N Pole2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01236 pDONR223 100% 86.2% 90.1% None (many diffs) n/a
2 ccsbBroad304_01236 pLX_304 0% 86.2% 90.1% V5 (many diffs) n/a
3 TRCN0000474915 GGCCCGATAGCTATAACCCTCTGA pLX_317 37.4% 86.2% 90.1% V5 (many diffs) n/a
4 ccsbBroadEn_06748 pDONR223 100% 82% 85.1% None (many diffs) n/a
5 ccsbBroad304_06748 pLX_304 0% 82% 85.1% V5 (many diffs) n/a
6 TRCN0000477166 CCATGAACGTACAGCCCCGTAACT pLX_317 27.6% 82% 85.1% V5 (many diffs) n/a
Download CSV