Transcript: Mouse NM_011163.4

Mus musculus eukaryotic translation initiation factor 2-alpha kinase 2 (Eif2ak2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eif2ak2 (19106)
Length:
4343
CDS:
190..1737

Additional Resources:

NCBI RefSeq record:
NM_011163.4
NBCI Gene record:
Eif2ak2 (19106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027041 CGCCAGGTTTAACAGCGATTT pLKO.1 894 CDS 100% 10.800 15.120 N Eif2ak2 n/a
2 TRCN0000274651 CGCCAGGTTTAACAGCGATTT pLKO_005 894 CDS 100% 10.800 15.120 N Eif2ak2 n/a
3 TRCN0000027014 CGTTAAATATAACACGGAGAA pLKO.1 1005 CDS 100% 4.050 5.670 N Eif2ak2 n/a
4 TRCN0000274653 GGAGTAGCCATTACGTATAAA pLKO_005 250 CDS 100% 15.000 10.500 N Eif2ak2 n/a
5 TRCN0000274652 GTGACCCACAGACATTGTATT pLKO_005 1862 3UTR 100% 13.200 9.240 N Eif2ak2 n/a
6 TRCN0000026989 CCTCCACATGACAGAAGGTTT pLKO.1 289 CDS 100% 4.950 3.465 N Eif2ak2 n/a
7 TRCN0000274650 CCTCCACATGACAGAAGGTTT pLKO_005 289 CDS 100% 4.950 3.465 N Eif2ak2 n/a
8 TRCN0000027026 GCAGCCAAATTAGCTGTTGAT pLKO.1 385 CDS 100% 4.950 3.465 N Eif2ak2 n/a
9 TRCN0000026988 GCCTCTTTATTCAAATGGAAT pLKO.1 1157 CDS 100% 4.950 3.465 N Eif2ak2 n/a
10 TRCN0000285728 GCCTCTTTATTCAAATGGAAT pLKO_005 1157 CDS 100% 4.950 3.465 N Eif2ak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.