Transcript: Mouse NM_011221.3

Mus musculus purine rich element binding protein B (Purb), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Purb (19291)
Length:
8478
CDS:
191..1165

Additional Resources:

NCBI RefSeq record:
NM_011221.3
NBCI Gene record:
Purb (19291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103493 GCGACAGAGGGATAAGCTTTA pLKO.1 1078 CDS 100% 10.800 15.120 N Purb n/a
2 TRCN0000363699 GCGACAGAGGGATAAGCTTTA pLKO_005 1078 CDS 100% 10.800 15.120 N Purb n/a
3 TRCN0000103491 CGTGGACTCGAAGCGCTTCTT pLKO.1 904 CDS 100% 1.650 1.320 N Purb n/a
4 TRCN0000312226 CGTGGACTCGAAGCGCTTCTT pLKO_005 904 CDS 100% 1.650 1.320 N Purb n/a
5 TRCN0000103490 CGGTATGCAGATGAAATGAAA pLKO.1 1046 CDS 100% 5.625 3.938 N Purb n/a
6 TRCN0000288282 CGGTATGCAGATGAAATGAAA pLKO_005 1046 CDS 100% 5.625 3.938 N Purb n/a
7 TRCN0000103494 TGCAGATGAAATGAAAGAGAT pLKO.1 1051 CDS 100% 4.950 3.465 N Purb n/a
8 TRCN0000375976 TGAAGCCGTCCTACCGCAATG pLKO_005 975 CDS 100% 2.000 1.400 N Purb n/a
9 TRCN0000155675 CAAGTACTACCTGGACCTCAA pLKO.1 613 CDS 100% 4.050 2.430 N PURB n/a
10 TRCN0000295617 CGAGAACCGCAAGTACTACCT pLKO_005 604 CDS 100% 2.640 1.584 N Purb n/a
11 TRCN0000014534 GCGCTTCTACCTGGACGTGAA pLKO.1 358 CDS 100% 1.350 0.810 N PURA n/a
12 TRCN0000297817 GCGCTTCTACCTGGACGTGAA pLKO_005 358 CDS 100% 1.350 0.810 N PURA n/a
13 TRCN0000103492 CAATGCCATCACCGTGCCCTT pLKO.1 991 CDS 100% 0.720 0.432 N Purb n/a
14 TRCN0000155624 CCAGAACAAGCGCTTCTACTT pLKO.1 349 CDS 100% 4.950 2.970 N PURB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06823 pDONR223 100% 90.3% 94.4% None (many diffs) n/a
2 ccsbBroad304_06823 pLX_304 0% 90.3% 94.4% V5 (many diffs) n/a
3 TRCN0000476532 GTACTTACTACTCCCACCAGCAAC pLX_317 38.6% 90.3% 94.4% V5 (many diffs) n/a
Download CSV