Transcript: Mouse NM_011240.3

Mus musculus RAN binding protein 2 (Ranbp2), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Mus musculus (mouse)
Gene:
Ranbp2 (19386)
Length:
9477
CDS:
129..9290

Additional Resources:

NCBI RefSeq record:
NM_011240.3
NBCI Gene record:
Ranbp2 (19386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101375 GCAGTTGAATTGATGCGTAAT pLKO.1 9324 3UTR 100% 10.800 15.120 N Ranbp2 n/a
2 TRCN0000326929 GCAGTTGAATTGATGCGTAAT pLKO_005 9324 3UTR 100% 10.800 15.120 N Ranbp2 n/a
3 TRCN0000101377 CCTGCATATAACTCCCAGTAT pLKO.1 2769 CDS 100% 4.950 6.930 N Ranbp2 n/a
4 TRCN0000306502 AGACTAGGGACTACCTGATAA pLKO_005 2266 CDS 100% 13.200 10.560 N Ranbp2 n/a
5 TRCN0000306503 TGAACCTCTAGGACGGATAAT pLKO_005 8837 CDS 100% 13.200 10.560 N Ranbp2 n/a
6 TRCN0000256742 AGTCAATGAAAGGATTCTATT pLKO_005 202 CDS 100% 13.200 9.240 N RGPD6 n/a
7 TRCN0000017742 GATTGCAGAATTGCTTTGTAA pLKO.1 425 CDS 100% 5.625 3.938 N RGPD4 n/a
8 TRCN0000101379 CCTGGCTATGTTAGTGAAGAA pLKO.1 7629 CDS 100% 4.950 3.465 N Ranbp2 n/a
9 TRCN0000326928 CCTGGCTATGTTAGTGAAGAA pLKO_005 7629 CDS 100% 4.950 3.465 N Ranbp2 n/a
10 TRCN0000101376 CCCTTGATTATGCAGATGAAT pLKO.1 3913 CDS 100% 5.625 3.375 N Ranbp2 n/a
11 TRCN0000101378 GCCCTTGATTATGCAGATGAA pLKO.1 3912 CDS 100% 4.950 2.970 N Ranbp2 n/a
12 TRCN0000326930 GCCCTTGATTATGCAGATGAA pLKO_005 3912 CDS 100% 4.950 2.970 N Ranbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.