Transcript: Mouse NM_011246.2

Mus musculus RAS guanyl releasing protein 1 (Rasgrp1), mRNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Rasgrp1 (19419)
Length:
5155
CDS:
169..2556

Additional Resources:

NCBI RefSeq record:
NM_011246.2
NBCI Gene record:
Rasgrp1 (19419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412458 TATCCCTGGATCTATACTATA pLKO_005 1412 CDS 100% 13.200 18.480 N Rasgrp1 n/a
2 TRCN0000077602 CGGAATAACCAACTGTTACAA pLKO.1 409 CDS 100% 5.625 7.875 N Rasgrp1 n/a
3 TRCN0000077601 CCAACTGAAGTACGCACAGAA pLKO.1 2463 CDS 100% 4.950 6.930 N Rasgrp1 n/a
4 TRCN0000077599 GCCCTTTACAATCATATCAAT pLKO.1 1321 CDS 100% 5.625 4.500 N Rasgrp1 n/a
5 TRCN0000426113 AGAACAAAGAGTCCCTTATAA pLKO_005 2348 CDS 100% 15.000 10.500 N Rasgrp1 n/a
6 TRCN0000077600 CCTTGTAAATAGCTGCGTAAA pLKO.1 864 CDS 100% 10.800 7.560 N Rasgrp1 n/a
7 TRCN0000445467 GCCCGCTTTACTGATTCATAC pLKO_005 2869 3UTR 100% 10.800 7.560 N Rasgrp1 n/a
8 TRCN0000077598 CCCGCTCATAACGGAAACAAT pLKO.1 2960 3UTR 100% 5.625 3.375 N Rasgrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489632 TATCATGCTGACCCAAGCCCCCGG pLX_317 14.8% 86.7% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV