Transcript: Mouse NM_011268.2

Mus musculus regulator of G-protein signaling 9 (Rgs9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rgs9 (19739)
Length:
2486
CDS:
188..2215

Additional Resources:

NCBI RefSeq record:
NM_011268.2
NBCI Gene record:
Rgs9 (19739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037136 CCCAAGAAAGTAGCCAACTTT pLKO.1 2048 CDS 100% 0.563 0.788 N Rgs9 n/a
2 TRCN0000037134 CCCAAGTGCATTAGGATAATA pLKO.1 2292 3UTR 100% 15.000 12.000 N Rgs9 n/a
3 TRCN0000037138 CCTTCCAAGCAATCCTTGGAT pLKO.1 979 CDS 100% 0.300 0.240 N Rgs9 n/a
4 TRCN0000037135 CCGATTTCAGACGCCATATTT pLKO.1 490 CDS 100% 15.000 10.500 N Rgs9 n/a
5 TRCN0000037137 CCTGGAATGAACAATGTGTTA pLKO.1 770 CDS 100% 4.950 3.465 N Rgs9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11303 pDONR223 100% 78.9% 83.3% None (many diffs) n/a
2 ccsbBroad304_11303 pLX_304 0% 78.9% 83.3% V5 (many diffs) n/a
3 TRCN0000479277 TTGTGGGATGGCGTGAGGCGCAGA pLX_317 15.3% 78.9% 83.3% V5 (many diffs) n/a
Download CSV