Transcript: Mouse NM_011339.2

Mus musculus chemokine (C-X-C motif) ligand 15 (Cxcl15), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cxcl15 (20309)
Length:
2127
CDS:
38..541

Additional Resources:

NCBI RefSeq record:
NM_011339.2
NBCI Gene record:
Cxcl15 (20309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112211 CCAATTACTAACAGGTTCCTA pLKO.1 296 CDS 100% 3.000 4.200 N Cxcl15 n/a
2 TRCN0000112212 CCCAATTACTAACAGGTTCCT pLKO.1 295 CDS 100% 2.640 3.696 N Cxcl15 n/a
3 TRCN0000314381 CCCAATTACTAACAGGTTCCT pLKO_005 295 CDS 100% 2.640 3.696 N Cxcl15 n/a
4 TRCN0000112214 CCTGAGAACAAGAGAATATTT pLKO.1 410 CDS 100% 15.000 10.500 N Cxcl15 n/a
5 TRCN0000314443 CCTGAGAACAAGAGAATATTT pLKO_005 410 CDS 100% 15.000 10.500 N Cxcl15 n/a
6 TRCN0000112210 CGTTCTCATTCTTATACTCTA pLKO.1 595 3UTR 100% 4.950 3.465 N Cxcl15 n/a
7 TRCN0000314444 CGTTCTCATTCTTATACTCTA pLKO_005 595 3UTR 100% 4.950 3.465 N Cxcl15 n/a
8 TRCN0000112213 GACCATTTACTGCAACAGAAA pLKO.1 196 CDS 100% 4.950 3.465 N Cxcl15 n/a
9 TRCN0000314380 GACCATTTACTGCAACAGAAA pLKO_005 196 CDS 100% 4.950 3.465 N Cxcl15 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1092 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.