Transcript: Mouse NM_011342.4

Mus musculus SEC22 homolog B, vesicle trafficking protein (Sec22b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sec22b (20333)
Length:
1815
CDS:
120..767

Additional Resources:

NCBI RefSeq record:
NM_011342.4
NBCI Gene record:
Sec22b (20333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011342.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380561 GATAGCCGTGCTCGGAGAAAT pLKO_005 501 CDS 100% 13.200 18.480 N Sec22b n/a
2 TRCN0000115089 CCCTATTCCTTCATCGAGTTT pLKO.1 444 CDS 100% 4.950 6.930 N Sec22b n/a
3 TRCN0000115087 CGGAGAAATCTAGGCTCCATT pLKO.1 513 CDS 100% 4.950 6.930 N Sec22b n/a
4 TRCN0000115088 GCTAACAATTTGTCCAGTCTA pLKO.1 627 CDS 100% 4.950 6.930 N Sec22b n/a
5 TRCN0000379600 GGATCATGGTGGCCAATATTG pLKO_005 559 CDS 100% 13.200 9.240 N Sec22b n/a
6 TRCN0000240495 TGGATTCAAAGGCTAACAATT pLKO_005 616 CDS 100% 13.200 9.240 N SEC22B n/a
7 TRCN0000379884 TGGATTCAAAGGCTAACAATT pLKO_005 616 CDS 100% 13.200 9.240 N Sec22b n/a
8 TRCN0000115090 CCACTGTGTCTAGGCCCTATT pLKO.1 430 CDS 100% 10.800 7.560 N Sec22b n/a
9 TRCN0000380631 CCTATTCCTTCATCGAGTTTG pLKO_005 445 CDS 100% 10.800 7.560 N Sec22b n/a
10 TRCN0000382042 TCATCATGCTGATAGTGTATG pLKO_005 727 CDS 100% 10.800 7.560 N Sec22b n/a
11 TRCN0000115086 GCCCTGCTTTACGAGAAGAAA pLKO.1 1663 3UTR 100% 5.625 3.938 N Sec22b n/a
12 TRCN0000240492 AGGATCATGGTGGCCAATATC pLKO_005 558 CDS 100% 13.200 9.240 N SEC22B n/a
13 TRCN0000164424 CCTTCCCTAAGAAGTTGGCTT pLKO.1 352 CDS 100% 2.640 1.848 N SEC22B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011342.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07444 pDONR223 100% 93.1% 100% None (many diffs) n/a
2 ccsbBroad304_07444 pLX_304 0% 93.1% 100% V5 (many diffs) n/a
3 TRCN0000474472 AAACTGTGATTACTCGCAATGAAC pLX_317 53.9% 93.1% 100% V5 (many diffs) n/a
Download CSV