Transcript: Mouse NM_011352.2

Mus musculus sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (Sema7a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sema7a (20361)
Length:
3290
CDS:
17..2011

Additional Resources:

NCBI RefSeq record:
NM_011352.2
NBCI Gene record:
Sema7a (20361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415138 GTGAACATCGGCTCCACAAAG pLKO_005 338 CDS 100% 10.800 15.120 N Sema7a n/a
2 TRCN0000439377 ACTCAGCTGTCTGCGTGTATT pLKO_005 1002 CDS 100% 13.200 10.560 N Sema7a n/a
3 TRCN0000415048 CTAAGTACCATTACCAGAAAG pLKO_005 1221 CDS 100% 10.800 8.640 N Sema7a n/a
4 TRCN0000067542 CCTAGCTGCATCCTGTTCATT pLKO.1 1790 CDS 100% 5.625 4.500 N Sema7a n/a
5 TRCN0000067539 CCATAGCTTTGTCTTCAATAT pLKO.1 1348 CDS 100% 13.200 9.240 N Sema7a n/a
6 TRCN0000446411 GCCATCCAGGCTATATCATTG pLKO_005 1400 CDS 100% 10.800 7.560 N Sema7a n/a
7 TRCN0000067541 CCAAGCCTATGATGATAAGAT pLKO.1 709 CDS 100% 5.625 3.938 N Sema7a n/a
8 TRCN0000067540 GCAGGAATACAACGGGAAGAT pLKO.1 589 CDS 100% 4.950 3.465 N Sema7a n/a
9 TRCN0000067538 GCATGTTTATTGAAGGATGTT pLKO.1 2511 3UTR 100% 4.950 3.465 N Sema7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01937 pDONR223 100% 87.5% 89% None (many diffs) n/a
2 ccsbBroad304_01937 pLX_304 0% 87.5% 89% V5 (many diffs) n/a
3 TRCN0000476524 GAATCGGAGGCCGCTCTTATATCA pLX_317 15.7% 87.5% 89% V5 (many diffs) n/a
Download CSV