Transcript: Mouse NM_011449.2

Mus musculus sperm autoantigenic protein 17 (Spa17), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Spa17 (20686)
Length:
700
CDS:
195..644

Additional Resources:

NCBI RefSeq record:
NM_011449.2
NBCI Gene record:
Spa17 (20686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078788 ACCGGACAATATACCAGCTTT pLKO.1 287 CDS 100% 4.950 6.930 N Spa17 n/a
2 TRCN0000326953 ACCGGACAATATACCAGCTTT pLKO_005 287 CDS 100% 4.950 6.930 N Spa17 n/a
3 TRCN0000078789 CTTCTATAACAACCACGCATT pLKO.1 395 CDS 100% 4.050 5.670 N Spa17 n/a
4 TRCN0000327012 CTTCTATAACAACCACGCATT pLKO_005 395 CDS 100% 4.050 5.670 N Spa17 n/a
5 TRCN0000078791 GCTTCTATAACAACCACGCAT pLKO.1 394 CDS 100% 2.640 3.696 N Spa17 n/a
6 TRCN0000078792 CTACCGAATTCCACAAGGATT pLKO.1 221 CDS 100% 0.000 0.000 N Spa17 n/a
7 TRCN0000306509 TGTGAACAAGAATTAGCTAAG pLKO_005 441 CDS 100% 6.000 4.800 N Spa17 n/a
8 TRCN0000078790 GCATTCAAGGAACAAGAACAA pLKO.1 411 CDS 100% 4.950 3.465 N Spa17 n/a
9 TRCN0000306511 CTTCGAGGAGTCTACTGAGGA pLKO_005 494 CDS 100% 2.640 1.848 N Spa17 n/a
10 TRCN0000306510 AGAGAAGAAACACCAGTCACT pLKO_005 471 CDS 100% 2.640 1.584 N Spa17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03386 pDONR223 100% 81.8% 70.8% None (many diffs) n/a
2 ccsbBroad304_03386 pLX_304 0% 81.8% 70.8% V5 (many diffs) n/a
3 TRCN0000474633 AATTTCAACTACACATACCGGTAC pLX_317 80.7% 81.8% 70.8% V5 (many diffs) n/a
Download CSV