Transcript: Mouse NM_011503.4

Mus musculus syntaxin binding protein 2 (Stxbp2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Stxbp2 (20911)
Length:
2703
CDS:
9..1790

Additional Resources:

NCBI RefSeq record:
NM_011503.4
NBCI Gene record:
Stxbp2 (20911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011503.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093274 CCCAGCTTGGAGGCAATTTAT pLKO.1 213 CDS 100% 15.000 10.500 N Stxbp2 n/a
2 TRCN0000093275 CCTAGGCTCATCGTGTACATT pLKO.1 1602 CDS 100% 5.625 3.938 N Stxbp2 n/a
3 TRCN0000093278 TGACTGCATGAAGCATTTCAA pLKO.1 1061 CDS 100% 5.625 3.938 N Stxbp2 n/a
4 TRCN0000093277 CTCTACATCCTTCTGCGGAAT pLKO.1 1233 CDS 100% 4.050 2.835 N Stxbp2 n/a
5 TRCN0000093276 CCTACAACCTTTACTGTCCAT pLKO.1 466 CDS 100% 2.640 1.848 N Stxbp2 n/a
6 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 2543 3UTR 100% 13.200 6.600 Y Ptcra n/a
7 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2551 3UTR 100% 2.640 1.320 Y Adsl n/a
8 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2551 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011503.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13961 pDONR223 100% 87.2% 94% None (many diffs) n/a
2 ccsbBroad304_13961 pLX_304 0% 87.2% 94% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV