Transcript: Mouse NM_011526.5

Mus musculus transgelin (Tagln), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Tagln (21345)
Length:
1586
CDS:
238..843

Additional Resources:

NCBI RefSeq record:
NM_011526.5
NBCI Gene record:
Tagln (21345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011526.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108753 CGACTAGTGGAGTGGATTGTA pLKO.1 322 CDS 100% 0.000 0.000 N Tagln n/a
2 TRCN0000335702 CGACTAGTGGAGTGGATTGTA pLKO_005 322 CDS 100% 0.000 0.000 N Tagln n/a
3 TRCN0000108751 GCACGTCATTGGCCTTCAAAT pLKO.1 753 CDS 100% 13.200 9.240 N Tagln n/a
4 TRCN0000335704 GCACGTCATTGGCCTTCAAAT pLKO_005 753 CDS 100% 13.200 9.240 N Tagln n/a
5 TRCN0000348672 TGCTTAGCCTGCCTCACAAAT pLKO_005 876 3UTR 100% 13.200 9.240 N Tagln n/a
6 TRCN0000108754 GCTGAAGAATGGTGTGATTCT pLKO.1 402 CDS 100% 0.495 0.347 N Tagln n/a
7 TRCN0000335703 GCTGAAGAATGGTGTGATTCT pLKO_005 402 CDS 100% 0.495 0.347 N Tagln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011526.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01638 pDONR223 100% 91% 97% None (many diffs) n/a
2 ccsbBroad304_01638 pLX_304 0% 91% 97% V5 (many diffs) n/a
3 TRCN0000468940 GCAGCTTGCAGGTTATGGCCTGCC pLX_317 64.5% 91% 97% V5 (many diffs) n/a
Download CSV