Transcript: Mouse NM_011577.2

Mus musculus transforming growth factor, beta 1 (Tgfb1), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Tgfb1 (21803)
Length:
2191
CDS:
868..2040

Additional Resources:

NCBI RefSeq record:
NM_011577.2
NBCI Gene record:
Tgfb1 (21803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065995 GCTGCGCTTGCAGAGATTAAA pLKO.1 1329 CDS 100% 15.000 10.500 N Tgfb1 n/a
2 TRCN0000301503 GCTGCGCTTGCAGAGATTAAA pLKO_005 1329 CDS 100% 15.000 10.500 N Tgfb1 n/a
3 TRCN0000065997 GCTCTTGTGACAGCAAAGATA pLKO.1 1535 CDS 100% 5.625 3.938 N Tgfb1 n/a
4 TRCN0000301570 GCTCTTGTGACAGCAAAGATA pLKO_005 1535 CDS 100% 5.625 3.938 N Tgfb1 n/a
5 TRCN0000065994 CGAAGCGGACTACTATGCTAA pLKO.1 1164 CDS 100% 4.950 3.465 N Tgfb1 n/a
6 TRCN0000301571 CGAAGCGGACTACTATGCTAA pLKO_005 1164 CDS 100% 4.950 3.465 N Tgfb1 n/a
7 TRCN0000065993 CGGCAGCTGTACATTGACTTT pLKO.1 1753 CDS 100% 4.950 3.465 N Tgfb1 n/a
8 TRCN0000301506 CGGCAGCTGTACATTGACTTT pLKO_005 1753 CDS 100% 4.950 3.465 N Tgfb1 n/a
9 TRCN0000065996 CCTGGATACCAACTATTGCTT pLKO.1 1704 CDS 100% 3.000 2.100 N Tgfb1 n/a
10 TRCN0000003317 CCCGCGTGCTAATGGTGGAAA pLKO.1 1193 CDS 100% 1.650 1.320 N TGFB1 n/a
11 TRCN0000318447 CCCGCGTGCTAATGGTGGAAA pLKO_005 1193 CDS 100% 1.650 1.320 N TGFB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07056 pDONR223 100% 85.1% 89.7% None (many diffs) n/a
2 ccsbBroad304_07056 pLX_304 17.4% 85.1% 89.7% V5 (many diffs) n/a
3 TRCN0000472904 TTTACCGTTTCTGAGATTACTGCC pLX_317 34.3% 85.1% 89.7% V5 (many diffs) n/a
Download CSV