Transcript: Mouse NM_011581.3

Mus musculus thrombospondin 2 (Thbs2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Thbs2 (21826)
Length:
5922
CDS:
391..3909

Additional Resources:

NCBI RefSeq record:
NM_011581.3
NBCI Gene record:
Thbs2 (21826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348728 GATTCGTGCTGTTCTATAATG pLKO_005 4353 3UTR 100% 13.200 18.480 N Thbs2 n/a
2 TRCN0000065398 GCCCTATTGATGGGTGCTTAT pLKO.1 2033 CDS 100% 10.800 15.120 N Thbs2 n/a
3 TRCN0000065399 GCTGTAGGTTTCGACGAGTTT pLKO.1 3385 CDS 100% 4.950 6.930 N Thbs2 n/a
4 TRCN0000351967 GCTGTAGGTTTCGACGAGTTT pLKO_005 3385 CDS 100% 4.950 6.930 N Thbs2 n/a
5 TRCN0000065401 CCAAGACAACTGCCCATACAT pLKO.1 3006 CDS 100% 5.625 4.500 N Thbs2 n/a
6 TRCN0000065402 CCACGTCAAGGACACTTCATT pLKO.1 450 CDS 100% 5.625 4.500 N Thbs2 n/a
7 TRCN0000351965 CCACGTCAAGGACACTTCATT pLKO_005 450 CDS 100% 5.625 4.500 N Thbs2 n/a
8 TRCN0000065400 CCATTCTATGAGCAGCTAGAA pLKO.1 922 CDS 100% 0.495 0.396 N Thbs2 n/a
9 TRCN0000351966 CCATTCTATGAGCAGCTAGAA pLKO_005 922 CDS 100% 0.495 0.396 N Thbs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07065 pDONR223 100% 83.8% 88.5% None (many diffs) n/a
2 ccsbBroad304_07065 pLX_304 0% 83.8% 88.5% V5 (many diffs) n/a
Download CSV