Transcript: Mouse NM_011600.3

Mus musculus transducin-like enhancer of split 4 (Tle4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tle4 (21888)
Length:
4755
CDS:
772..3093

Additional Resources:

NCBI RefSeq record:
NM_011600.3
NBCI Gene record:
Tle4 (21888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098289 CCTCCCAATTAAGGATGAGAA pLKO.1 1314 CDS 100% 4.950 6.930 N Tle4 n/a
2 TRCN0000098286 CGGCATTATGTCATGTATTAT pLKO.1 964 CDS 100% 15.000 12.000 N Tle4 n/a
3 TRCN0000160491 CCAGAAACATTGTGTTATCTT pLKO.1 4203 3UTR 100% 5.625 4.500 N TLE4 n/a
4 TRCN0000098285 CGCTGTGCAAAGCAAGTCTTT pLKO.1 4025 3UTR 100% 4.950 3.465 N Tle4 n/a
5 TRCN0000098287 CCTCCAAATCTAACAGGCATT pLKO.1 2077 CDS 100% 4.050 2.835 N Tle4 n/a
6 TRCN0000098288 CCAGACAAATACCAGTTGCAT pLKO.1 2845 CDS 100% 3.000 2.100 N Tle4 n/a
7 TRCN0000165843 GCAGAACTGAACGCCATCATT pLKO.1 1138 CDS 100% 5.625 3.375 N TLE4 n/a
8 TRCN0000275237 GCAGAACTGAACGCCATCATT pLKO_005 1138 CDS 100% 5.625 3.375 N TLE4 n/a
9 TRCN0000166665 CCAAAGAGACAGAGACTCCAT pLKO.1 1356 CDS 100% 2.640 1.584 N TLE4 n/a
10 TRCN0000275190 CCAAAGAGACAGAGACTCCAT pLKO_005 1356 CDS 100% 2.640 1.584 N TLE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11192 pDONR223 100% 84.2% 90.8% None (many diffs) n/a
2 ccsbBroad304_11192 pLX_304 0% 84.2% 90.8% V5 (many diffs) n/a
Download CSV