Transcript: Mouse NM_011614.3

Mus musculus tumor necrosis factor (ligand) superfamily, member 12 (Tnfsf12), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tnfsf12 (21944)
Length:
1694
CDS:
345..1094

Additional Resources:

NCBI RefSeq record:
NM_011614.3
NBCI Gene record:
Tnfsf12 (21944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362838 ACTCACCCGACCACGTGTTTA pLKO_005 1352 3UTR 100% 13.200 18.480 N Tnfsf12 n/a
2 TRCN0000066324 CCTAACCTACTTTGGACTCTT pLKO.1 1061 CDS 100% 4.950 6.930 N Tnfsf12 n/a
3 TRCN0000362908 ACGTATCCTTGCTCTTCTTTA pLKO_005 1259 3UTR 100% 13.200 9.240 N Tnfsf12 n/a
4 TRCN0000362839 TAACCTACTTTGGACTCTTTC pLKO_005 1063 CDS 100% 10.800 6.480 N Tnfsf12 n/a
5 TRCN0000066323 CGAGCTATTGCAGCCCATTAT pLKO.1 657 CDS 100% 13.200 6.600 Y Tnfsf12 n/a
6 TRCN0000281904 GAGCTATTGCAGCCCATTATG pLKO_005 658 CDS 100% 13.200 6.600 Y Tnfsfm13 n/a
7 TRCN0000066325 CCTCGAAGAAGTGCTCCTAAA pLKO.1 615 CDS 100% 10.800 5.400 Y Tnfsf12 n/a
8 TRCN0000373711 CTGTACTGTCAGGTGCACTTT pLKO_005 831 CDS 100% 4.950 2.475 Y TNFSF12 n/a
9 TRCN0000066327 GAATTTACAGTCATCAGGGCT pLKO.1 798 CDS 100% 0.660 0.330 Y Tnfsf12 n/a
10 TRCN0000066326 GTACCTTTCTTGGAACAACTA pLKO.1 588 CDS 100% 0.000 0.000 Y Tnfsf12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07293 pDONR223 99.4% 88.5% 89.1% None (many diffs) n/a
2 ccsbBroad304_07293 pLX_304 0% 88.5% 89.1% V5 (many diffs) n/a
3 TRCN0000475473 TACGTGCAGATCGTGCACATACGC pLX_317 29.7% 88.5% 89.1% V5 (many diffs) n/a
Download CSV