Construct: ORF TRCN0000475473
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005019.1_s317c1
- Derived from:
- ccsbBroadEn_07293
- DNA Barcode:
- TACGTGCAGATCGTGCACATACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNFSF12 (8742)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475473
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8742 | TNFSF12 | TNF superfamily member 12 | NM_003809.3 | 100% | 100% | |
2 | human | 407977 | TNFSF12-TNFSF13 | TNFSF12-TNFSF13 readthrough | NM_172089.4 | 67.4% | 55.1% | (many diffs) |
3 | human | 8742 | TNFSF12 | TNF superfamily member 12 | NR_037146.2 | 46.2% | 1_96del;467_705del;1083_1616del | |
4 | mouse | 21944 | Tnfsf12 | tumor necrosis factor (liga... | NM_011614.3 | 88.5% | 89.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 816
- ORF length:
- 747
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccgcccgt cggagccaga ggcggagggg gcgccggggg gagccgggca 121 ccgccctgct ggtcccgctc gcgctgggcc tgggcctggc gctggcctgc ctcggcctcc 181 tgctggccgt ggtcagtttg gggagccggg catcgctgtc cgcccaggag cctgcccagg 241 aggagctggt ggcagaggag gaccaggacc cgtcggaact gaatccccag acagaagaaa 301 gccaggatcc tgcgcctttc ctgaaccgac tagttcggcc tcgcagaagt gcacctaaag 361 gccggaaaac acgggctcga agagcgatcg cagcccatta tgaagttcat ccacgacctg 421 gacaggacgg agcgcaggca ggtgtggacg ggacagtgag tggctgggag gaagccagaa 481 tcaacagctc cagccctctg cgctacaacc gccagatcgg ggagtttata gtcacccggg 541 ctgggctcta ctacctgtac tgtcaggtgc actttgatga ggggaaggct gtctaccTGA 601 AGCTGGACTT GCTGGTGGAT GGTGTGCTGG CCCTGCGCTG CCTGGAGGAA TTCTCAGCCA 661 CTGCGGCGAG TTCCCTCGGG CCCCAGCTCC GCCTCTGCCA GGTGTCTGGG CTGTTGGCCC 721 TGCGGCCAGG GTCCTCCCTG CGGATCCGCA CCCTCCCCTG GGCCCATCTC AAGGCTGCCC 781 CCTTCCTCAC CTACTTCGGA CTCTTCCAGG TTCACTTGCC AACTTTCTTG TACAAAGTGG 841 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 901 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 961 ATACGTGCAG ATCGTGCACA TACGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1021 aatttgtgaa agatt