Transcript: Mouse NM_011626.2

Mus musculus transmembrane protein 165 (Tmem165), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem165 (21982)
Length:
1896
CDS:
267..1238

Additional Resources:

NCBI RefSeq record:
NM_011626.2
NBCI Gene record:
Tmem165 (21982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306411 ATCATGGCGATGCGCTATAAC pLKO_005 621 CDS 100% 13.200 18.480 N Tmem165 n/a
2 TRCN0000375786 TTGTTCAAGCGCTCACATTAA pLKO_005 973 CDS 100% 13.200 18.480 N Tmem165 n/a
3 TRCN0000119337 CCTCCACTTCTGCTTGATATA pLKO.1 1471 3UTR 100% 13.200 10.560 N Tmem165 n/a
4 TRCN0000119341 CAACGAACCAAACTCTTAAAT pLKO.1 879 CDS 100% 15.000 10.500 N Tmem165 n/a
5 TRCN0000375857 TGGGTTCTCTCTAGCTTAATT pLKO_005 1435 3UTR 100% 15.000 10.500 N Tmem165 n/a
6 TRCN0000306412 AGAAGTCCAAGCAGAGTTAAA pLKO_005 839 CDS 100% 13.200 9.240 N Tmem165 n/a
7 TRCN0000119339 CCAACGAACCAAACTCTTAAA pLKO.1 878 CDS 100% 13.200 9.240 N Tmem165 n/a
8 TRCN0000326897 CCAACGAACCAAACTCTTAAA pLKO_005 878 CDS 100% 13.200 9.240 N Tmem165 n/a
9 TRCN0000306410 GGGTTTAATGTATACCTTAAG pLKO_005 1574 3UTR 100% 10.800 7.560 N Tmem165 n/a
10 TRCN0000119340 CGCTCTCAACTCACTACCATT pLKO.1 1017 CDS 100% 4.950 3.465 N Tmem165 n/a
11 TRCN0000152975 GATTGGCAGTAATTGGAGGAA pLKO.1 1108 CDS 100% 2.640 1.848 N TMEM165 n/a
12 TRCN0000119338 CCCAGACGAATCTGGGATTTA pLKO.1 526 CDS 100% 1.320 0.924 N Tmem165 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12284 pDONR223 100% 56.1% 61.1% None (many diffs) n/a
2 ccsbBroad304_12284 pLX_304 0% 56.1% 61.1% V5 (many diffs) n/a
3 TRCN0000474428 GGGCGCGAGGCGGTCAGCTCTGCT pLX_317 90.2% 56.1% 61.1% V5 (many diffs) n/a
Download CSV