Transcript: Mouse NM_011648.5

Mus musculus thyroid stimulating hormone receptor (Tshr), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tshr (22095)
Length:
4332
CDS:
93..2387

Additional Resources:

NCBI RefSeq record:
NM_011648.5
NBCI Gene record:
Tshr (22095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011648.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027851 CCCAAGCAACTCTCACTATTA pLKO.1 1130 CDS 100% 13.200 10.560 N Tshr n/a
2 TRCN0000027811 GCCTCTAATCACTGTTACTAA pLKO.1 2045 CDS 100% 5.625 3.938 N Tshr n/a
3 TRCN0000027795 CCCAACATGCAAGATACCTAT pLKO.1 2289 CDS 100% 4.950 3.465 N Tshr n/a
4 TRCN0000027838 CCTGGAGTCTTTGATGTGTAA pLKO.1 977 CDS 100% 4.950 3.465 N Tshr n/a
5 TRCN0000027779 GCTCATCGAGACTCATCTGAA pLKO.1 266 CDS 100% 4.950 3.465 N Tshr n/a
6 TRCN0000014202 GCTGTTTACCTAAACAAGAAT pLKO.1 702 CDS 100% 0.563 0.338 N TSHR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011648.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487846 GCACAGAACTCCCCGGGAGCTATC pLX_317 11% 86.2% 86.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV