Transcript: Mouse NM_011652.3

Mus musculus titin (Ttn), transcript variant N2-A, mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttn (22138)
Length:
101674
CDS:
224..100627

Additional Resources:

NCBI RefSeq record:
NM_011652.3
NBCI Gene record:
Ttn (22138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362964 CCACGAAGATGGTGGTATTTA pLKO_005 52192 CDS 100% 15.000 21.000 N Ttn n/a
2 TRCN0000362962 GCGCAGTGGGATAGGATTAAT pLKO_005 53894 CDS 100% 15.000 21.000 N Ttn n/a
3 TRCN0000088743 CGGCCAAAGTTCCTGAAATTA pLKO.1 33366 CDS 100% 15.000 12.000 N Ttn n/a
4 TRCN0000088745 CCGTTGAAAGACAGCCCAAAT pLKO.1 24491 CDS 100% 10.800 8.640 N Ttn n/a
5 TRCN0000363030 CCGGAAAGAAAGCTGATTATT pLKO_005 5207 CDS 100% 15.000 10.500 N Ttn n/a
6 TRCN0000088744 GCCCAGTAACAAATATGAAAT pLKO.1 26299 CDS 100% 13.200 9.240 N Ttn n/a
7 TRCN0000088746 CCAGAGAGAAAGCGAATGTAA pLKO.1 38892 CDS 100% 5.625 3.938 N Ttn n/a
8 TRCN0000088747 CCCTTCACATTGGAGTGTGTA pLKO.1 20186 CDS 100% 4.950 2.970 N Ttn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.