Transcript: Mouse NM_011715.2

Mus musculus WD repeat domain 1 (Wdr1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Wdr1 (22388)
Length:
2878
CDS:
65..1885

Additional Resources:

NCBI RefSeq record:
NM_011715.2
NBCI Gene record:
Wdr1 (22388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108914 GATGGCTATTCGGAGAATAAT pLKO.1 1622 CDS 100% 15.000 12.000 N Wdr1 n/a
2 TRCN0000295272 GCACCCTTCTCTTAACTATTT pLKO_005 1940 3UTR 100% 13.200 10.560 N Wdr1 n/a
3 TRCN0000435904 CGAATCAGGGACTAGAGTTTA pLKO_005 1908 3UTR 100% 13.200 9.240 N WDR1 n/a
4 TRCN0000108911 GCCATGATGGACATATCAATT pLKO.1 1086 CDS 100% 13.200 9.240 N Wdr1 n/a
5 TRCN0000287911 GCCATGATGGACATATCAATT pLKO_005 1086 CDS 100% 13.200 9.240 N Wdr1 n/a
6 TRCN0000295338 CATCCTAAGAAACATCGATAA pLKO_005 184 CDS 100% 10.800 7.560 N Wdr1 n/a
7 TRCN0000108913 GCTGATGGCTATTCGGAGAAT pLKO.1 1619 CDS 100% 4.950 3.465 N Wdr1 n/a
8 TRCN0000287987 GCTGATGGCTATTCGGAGAAT pLKO_005 1619 CDS 100% 4.950 3.465 N Wdr1 n/a
9 TRCN0000108912 GCTGGGAAGATCAAGGACATT pLKO.1 368 CDS 100% 4.950 3.465 N Wdr1 n/a
10 TRCN0000287910 GCTGGGAAGATCAAGGACATT pLKO_005 368 CDS 100% 4.950 3.465 N Wdr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07517 pDONR223 100% 87.6% 95% None (many diffs) n/a
2 ccsbBroad304_07517 pLX_304 0% 87.6% 95% V5 (many diffs) n/a
3 TRCN0000467511 GCCGTTCCTTTTTTGCCCACTACG pLX_317 17.5% 87.6% 95% V5 (many diffs) n/a
4 ccsbBroadEn_07516 pDONR223 100% 87.6% 95.2% None (many diffs) n/a
5 ccsbBroad304_07516 pLX_304 0% 87.6% 95.2% V5 (many diffs) n/a
6 TRCN0000472452 CATGGAAGTGTCAGTGTGATCTGT pLX_317 26.8% 87.6% 95.2% V5 (many diffs) n/a
Download CSV