Transcript: Mouse NM_011731.3

Mus musculus solute carrier family 6 (neurotransmitter transporter), member 20B (Slc6a20b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc6a20b (22599)
Length:
3287
CDS:
207..2114

Additional Resources:

NCBI RefSeq record:
NM_011731.3
NBCI Gene record:
Slc6a20b (22599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079664 GCCTTACTTTGTGCTCATCAT pLKO.1 941 CDS 100% 4.950 3.960 N Slc6a20b n/a
2 TRCN0000079666 GCCCACTGAATAGTAATCACA pLKO.1 712 CDS 100% 3.000 2.400 N Slc6a20b n/a
3 TRCN0000079665 GACTAAGGATTATCCTACATA pLKO.1 1976 CDS 100% 5.625 3.938 N Slc6a20b n/a
4 TRCN0000079663 ACTTCCTGTCAGTCACTGTTT pLKO.1 2133 3UTR 100% 4.950 3.465 N Slc6a20b n/a
5 TRCN0000079667 CCTACTTGTCTGTATCTCCTA pLKO.1 377 CDS 100% 2.640 1.848 N Slc6a20b n/a
6 TRCN0000070186 CCCTACATCATCATGCTCATT pLKO.1 471 CDS 100% 4.950 2.475 Y Slc6a20a n/a
7 TRCN0000038354 GAGATTTGAAAGTGACCTTAA pLKO.1 1796 CDS 100% 10.800 5.400 Y SLC6A20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08406 pDONR223 100% 79% 81.2% None (many diffs) n/a
2 ccsbBroad304_08406 pLX_304 0% 79% 81.2% V5 (many diffs) n/a
3 TRCN0000473895 TTATTGCACGAAAATGGTTAAAAG pLX_317 21.2% 79% 81.2% V5 (many diffs) n/a
Download CSV